THERYA NOTES 2024, Vol. 5 : 92-102 DOI: 10.12933/therya_notes-24-156 ISSN 2954-3614
First record of Coxiella sp. in Ornithodoros hasei parasitizing Rhogeessa tumida in México
Primer registro de Coxiella sp. en Ornithodoros hasei parasitando a Rhogeessa tumida en México
Estefanía Grostieta1, Sebastián Muñoz-Leal2, Héctor M. Zazueta-Islas1, Marlene Solís-Cortés1, Fernanda Flores-Vázquez1, Gerardo G. Ballados-González3, Pablo Colunga-Salas1,4, Ingeborg Becker1, Juan Manuel Pech-Canché5, and Sokani Sánchez-Montes1,5*
1Centro de Medicina Tropical, Unidad de Investigación en Medicina Experimental, Facultad de Medicina, Universidad Nacional Autónoma de México. Dr. Balmis 148, C. P. 06726, Ciudad de México. Ciudad de México, México. E-mail: estefania.grostieta@ciencias.unam.mx (E-G); manuzazueta@ciencias.unam.mx (HM-ZI); marlenesolis@ciencias.unam.mx (M-SC); ferflores@ciencias.unam.mx (F-FV); becker@unam.mx (I-B).
2Departamento de Ciencia Animal, Facultad de Ciencias Veterinarias, Universidad de Concepción. Av. Vicente Méndez 595, Chillán. Concepción, Chile. E- mail: sebamunoz@udec.cl (S-ML).
3Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana. Miguel Ángel de Quevedo s/n, esq. Yáñez, C. P. 91710, Veracruz. Veracruz, México. E-mail: balladosgerardo506@hotmail.com (GG-BG).
4Instituto de Biotecnología y Ecología Aplicada, Universidad Veracruzana. Campus para la Cultura, las Artes y el Deporte, Cultura Veracruzana No. 101, Emiliano Zapata, C. P. 91090, Xalapa de Enríquez. Veracruz, México. E-mail: pcolunga@uv.mx (P-CS).
5Facultad de Ciencias Biológicas y Agropecuarias región Poza Rica-Tuxpan, Universidad Veracruzana. Carretera Tuxpan Tampico Kilómetro 7.5 Universitaria, C. P. 92870, Tuxpan de Rodríguez Cano. Veracruz, México. E-mail: jmpech@uv.mx (JM-PC); sok10108@gmail.com (S-SM).
*Corresponding author
Soft ticks represent a neglected group of ectoparasites associated with a wide range of vertebrates. In México, 24 species have been reported, the majority parasitizing bats. Several species are competent vectors of a wide range of pathogenic microorganisms. For this reason, the aim of the present work was to identify ticks associated with bats from Tuxpan de Rodriguez Cano, Veracruz, México. Bats were captured using mist nets and were visually inspected for tick presence. The ectoparasites were identified morphologically and molecularly with the use of the mitochondrial marker 16SrDNA, and molecular detection of several bacterial and protozoan pathogens was also performed. Twenty-five bats of 9 species were inspected. We collected 7 tick larvae morphologically identified as Ornithodoros hasei from a female black-winged little yellow bat (Rhogeessa tumida). Sequencing of the 400-bp fragment of the 16S rDNA gene, demonstrated a similarity of 96 % (373/388 bp) with O. hasei from Argentina and Brazil. In addition, the presence of Coxiella sp. was confirmed. Our findings provide relevant information on the biology of O. hasei by identifying R. tumida as a new host, providing the most north-eastern record for the geographical distribution of this tick in the Gulf of México and detecting the presence of a new endosymbiont in this tick.
Key words: Bats; biodiversity; ectoparasites; endosymbiont; México; soft tick.
Las garrapatas blandas representan un grupo desatendido de ectoparásitos asociadas con una amplia gama de vertebrados. En México se han reportado 24 especies, la mayoría parasitando murciélagos. Varias especies son vectores competentes de una amplia gama de microorganismos patógenos. Por esta razón, el objetivo del presente trabajo fue identificar garrapatas asociadas con murciélagos de Tuxpan de Rodríguez Cano, Veracruz, México. Los murciélagos fueron capturados usando redes de niebla y fueron inspeccionados visualmente para detectar la presencia de garrapatas. Los ectoparásitos se identificaron morfológica y molecularmente con el uso del marcador mitocondrial 16SrDNA. Adicionalmente, se realizó la detección molecular de varios patógenos bacterianos y protozoarios. Se inspeccionaron 25 murciélagos de 9 especies. Se recolectaron 7 larvas de garrapatas identificadas morfológicamente como Ornithodoros hasei de una hembra de murciélago amarillo de alas negras (Rhogeessa tumida). La secuenciación del fragmento de 400 pb del gen 16S rDNA demostró una similitud del 96 % (373/388 pb) con O. hasei de Argentina y Brasil. Adicionalmente, se confirmó la presencia de Coxiella sp. Nuestros hallazgos proporcionan información relevante sobre la biología de O. hasei al identificar a R. tumida como un nuevo huésped, proporcionando el registro más nororiental para la distribución geográfica de esta garrapata en el Golfo de México y detectando la presencia de un nuevo huésped-endosimbionte en esta garrapata.
Palabras clave: Biodiversidad; ectoparásitos; endosimbionte; garrapatas blandas; México; murciélagos.
© 2024 Asociación Mexicana de Mastozoología, www.mastozoologiamexicana.org
Ticks are hematophagous ectoparasites associated with a great variety of vertebrates, among which mammals stand out. The existence of 3 living families and a fossil one is recognized, among which the soft ticks of the Argasidae family are prominent members. Currently, this family is composed by near 220 known species, which exhibit nesting behavior, as they remain within the dens of the hosts and feed on multiple occasions throughout their life cycle (Mans et al. 2019). Soft ticks are vectors of a wide range of pathogenic microorganisms, among which members of the genera Borrelia and Rickettsia are recognized (Parola and Raoult 2001). In particular, many members of the genus Ornithodoros are parasites of bats (Sándor et al. 2021).
Twenty-four species of the genus Ornithodoros occur in México, more than half of them are associated with bats (Guzmán-Cornejo et al. 2019). However, in the country, information on microorganisms related to Ornithodoros that parasitize bats is scarce and scattered. A single record described Rickettsia lusitaniae in Ornithodoros yumatensis from the Yucatán Peninsula, and in an undetermined Ornithodoros sp. of unknown geographic origin (Sánchez-Montes et al. 2016; Hornok et al. 2019). Nevertheless, in other countries of the Neotropical region, a wide range of potentially zoonotic microorganisms (e.g., Borrelia sp.) have been identified in ticks parasitizing bats of the Emballonuridae, Mormoopidae, Noctilionidae, Phyllostomidae and Vespertilionidae families (Muñoz-Leal et al. 2021).
Ornithodoros hasei, a member of the Ornithodoros talaje group, is one of the most common and abundant soft ticks associated with bats across the Neotropical region and exhibits a wide distribution that ranges from northern México to Argentina (Colombo et al. 2020). This species has been recorded in association with 42 species of 26 genera of bats of the Emballonuridae, Mormoopidae, Noctilionidae, Phyllostomidae and Vespertilionidae families and 1 rodent species in 11 countries of the Neotropical region (Figure 1; Appendix 1). In México, records of O. hasei are scarce, with a first report made in the states of Yucatán and Sinaloa in 1963, and again in 2000 for both states (Kohls et al. 1965; Guzmán-Cornejo et al. 2019).
This tick species has recently been studied in South America for the presence of microorganisms, among which the presence of Candidatus Rickettsia wissemanii stands out, a new species from the spotted fever group (whose pathogenicity is unknown), which was detected in Argentina, Brazil, and French Guiana (Tahir et al. 2016; Luz et al. 2019; Colombo et al. 2020). Additionally, an uncharacterized member of the Bartonella genus has been detected in French Guiana (Davoust et al. 2016). However, no studies have been performed to identify other potentially pathogenic bacterial or parasitic agents in this tick species.
The aim of this study was to perform a morphological and molecular identification of soft ticks collected from bats, and to provide new records of tick-bat associations in México. Moreover, we aimed to detect tick-borne bacteria (Anaplasma, Bartonella, Borrelia, Coxiella, Ehrlichia, and Rickettsia) and protozoa (Babesia and Hepatozoon) in the collected ticks.
During a field journey on February 27, 2020, we trapped bats using mist nets at the ecotourism centre San Basilio (20º 58´03´´N, 97º 21´ 12´´W) located in the municipality of Tuxpan de Rodríguez Cano, Veracruz. Bats were collected from 20 to 22 hr. The specimens were carefully removed from the nets, identified with the help of specialized morphological keys of Medellín et al. (2007), and individualized in blanket bags. Each specimen was checked externally for the presence of ticks, which were collected with the help of forceps and fixed in 70 % ethanol. Once the procedure was finished, the mammals were released in situ.
For DNA extraction from ticks, a small incision was made behind the fourth pair of legs with a sterile needle for each specimen. Subsequently, the individuals were placed in a Cheelex-100 solution following the methodology of Aguilar-Domínguez et al. (2019). The exoskeletons were recovered and mounted on semi-permanent slides using Hoyer’s medium to perform a morphological identification following Kohls et al. (1965). For molecular identification of the specimens, a 400-bp fragment of the mitochondrial 16S rRNA gene was amplified using the primers and thermal conditions according to Norris et al. (1996). Subsequently, conventional polymerase chain reactions (PCRs) were performed using specific primers to detect of several bacterial and protozoan pathogens, which are listed in Appendix 2. The reaction mixture was prepared in a final volume of 25 μL, using 12.5 μL of 2× GoTaq Green Master Mix (Promega Corporation, Madison, WI, USA), 2 μL of primers (2 μM, 1 μL each), 8.5 μL nuclease-free water and 500 ng DNA of each sample (2 μL).
Negative (nuclease free water) and positive (DNA of Anaplasma ovis [MG733099], Bartonella vinsonii vinsonii [KT326174], Ehrlichia canis [MH917714], Hepatozoon sp. from Crotalus molossus [MT385834], Rickettsia amblyommatis [KX363842], and Theileria equi [MT828308]) controls were included. Amplicons were sequenced at Macrogen, Korea. Finally, the sequences generated were compared to those deposited in GenBank using the BLAST-n tool. Additionally, for ticks and tick-borne pathogens, we made a phylogenetic reconstruction using the Maximum Likelihood method. We selected the best nucleotide substitution model using the Bayesian information criterion (BIC) and the maximum likelihood value (lnL) in MEGA v.10. Branch support was estimated using 10000 non-parametric bootstraps. Finally, to ascertain genetic diversity between the tick populations recovered in this study and those deposited in GenBank, we calculated the number of haplotypes and the number of unique haplotypes in DNAsp 5.10. To identify the relationship among haplotypes, minimal union networks were constructed using the program PopArt.
Bats collected correspond to 9 species of 2 families: Phyllostomidae (23 specimens: 15 Artibeus jamaicensis, 1 Artibeus lituratus, 3 Chiroderma salvini, 1 Dermanura phaeotis, 1 Glossophaga soricina, 1 Platyrrhinus helleri, and 1 Sturnira ludovici) and Vespertilionidae (2 specimens: 1 Epistecus furinalis, and 1 Rhogeesa tumida). A single R. tumida female was recorded to be infested by ticks. A total of 7 larvae were identified morphologically as O. hasei, because of the following traits: dorsal plate pyriform, 14 pairs of dorsolateral setae and 4 pairs of central setae; pointed hypostome with 3 rows of denticles (19 denticles in row I; 18 in row II, and 9 in row III); dentition formula 3/3 in the anterior two-thirds, then 2/2 towards the base (Figure 2a-c; Kohls et al. 1965). We recovered 400-bp sequences of the 16S-rRNA gene from all collected specimens. The sequences showed a similarity of 99 %–100 % (388/399 bp) among each other and 96 % (373/388 bp) with sequences of O. hasei from Brazil and Argentina (GenBank accession numbers MH600060 and MT077216). The phylogenetic analysis confirmed the identity of the species, grouping the reference sequences with those generated in the present work in a monophyletic clade with a support value of 99 % (Figure 2d).
We detected the presence of 9 haplotypes of O. hasei (Figure 2b). The most frequent haplotype detected was H5, with 3 sequences (27.3 %), followed by haplotype H2 with 2 (18.2 %). The remaining haplotypes were recorded once each one. None of the haplotypes was detected in more than one country. In México, only 2 haplotypes were detected that differ between 12 and 13 mutational steps with the other haplotypes detected in South America (Figure 2e).
For tick-borne pathogen detection, all ticks were tested individually by PCR. Of these, 2 ticks (28.5 %) produced the expected PCR products for the 16S-rRNA gene of Coxiella. The sequences obtained were 100 % (615/615 bp) identical to each other; according to the BLAST analysis, our sequences were 99 % (610/615 bp) identical to that of the C. burnetii isolate of Hyalomma asiaticum from China (GenBank accession number MN880312). The phylogenetic analysis grouped our sequences in a monophyletic clade (support value of 95 %) with those of Coxiella endosymbionts isolated from other Ornithodoros species and several linages of C. burnetii, which belong to clade A (Figure 3).
The presence of DNA from other bacterial or parasitic agents was not detected. The obtained sequences were deposited in GenBank under the following accessions numbers: Ornithodoros 16S-rDNA (OL881234-36), and Coxiella 16S-rDNA (OL898409).
In México, records of ticks associated with bats of the Vespertilionidae family are scarce, with only 5 host species examined (Corynorhinus mexicanus, Myotis nigricans extremus, M. velifer, M. vivesi and, Parastrellus hesperus), which have been recorded in association with 5 soft tick species (Ornithodoros yumatensis, O. brodyi, O. hasei, O. dyeri, and O. rossi, respectively; Guzmán-Cornejo et al. 2019).
We identified for the first time the presence of a tick parasitizing R. tumida, particularly the soft tick O. hasei. Although Jones et al. (1972) mention the presence of O. hasei in R. tumida collected in Venezuela (Appendix 1), phylogenetic studies carried out identified the existence of the tumida-parvula species complex. Subsequent phylogenetic studies demonstrated the presence of 10 species of the genus Rhogeesa across the Neotropical region (Baird et al. 2009). In the case of R. tumida, this species has a restricted distribution ranging from northeastern México, through Central America, to the south of Brazil, Bolivia, and Ecuador, whereas the only species described for Venezuela is the tiny yellow bat (Rhogeessa minutilla), species in which the presence of O. hasei has been demonstrated in Colombia (Marinkelle and Grose 1981; Baird et al. 2009; Ceballos 2014). The present work increases the inventory of ectoparasites associated with R. tumida, since there are only historical records of the nycteribiid fly Basilia anomala from México (Guimaraes and D’Andretta 1956) and Guatemala (Theodor 1967) and the myobiid mite Acanthophthirius longus from Guatemala (Uchikawa and Baker 1993). To the best of our knowledge, there are only 3 previous historical records of O. hasei parasitizing members of the genus Rhogeessa: the tiny yellow bat (R. minutilla), one unidentified specimen from Venezuela, and the little yellow bat (R. parvula) from Colombia (Jones et al. 1972; Marinkelle and Grose 1981; Appendix 1). So, this work provides a new parasite–host association for this bat genus.
Our findings add a new location for O. hasei in México: this record represents the most northern finding of O. hasei on the Gulf of México, particularly in the transition zone with the Nearctic region (Guzmán-Cornejo et al. 2019). Furthermore, it is important to clarify that O. hasei is distributed from the north-west of México (Sinaloa) to Argentina and not from the southern part of México to Argentina, as mentioned by other authors (Davoust et al. 2016; Figure 1).
Additionally, this new record adds novel and valuable taxonomic information about the species. Since the description of this taxon in 1972 by Jones et al., there has been an intense debate regarding the taxonomy of this species. The variability in the total length of the specimens from different countries of South America and the Caribbean (Jones et al. 1972) has led to the proposal of the existence of possible cryptic species (Muñoz-Leal et al. 2018). The TCS network (statistical parsimony) revealed the presence of many unique and intermediate haplotypes (probably non-sampled haplotypes) from South American populations of O. hasei (Figure 3). This is consistent with the subsampling of this species throughout the Neotropical region, such as in the case of Amblyomma aureolatum from Brazil (Bitencourth et al. 2021). Our new data will help to elucidate the possible presence of a cryptic species complex or intraspecies variability. It is crucial to continue processing new morphological, molecular, and ecological data about O. hasei in order to clarify their taxonomic status.
Our current work also presents the first record of a Coxiella sp. in O. hasei, and the second one of this bacteria genus in a soft tick associated with bats, since the only previous record is from Ornithodoros peruvianus associated with Desmodus rotundus in Chile (Duron et al. 2015). In addition, our work represents the first molecular typification of Coxiella sp. in México since this bacterial genus was previously detected using Next Generation Sequencing in the soft tick Ornithodoros turicate from the Bolson tortoise (Ghopherus flavimarginatus) in the northern Mapimi Biosphere Reserve (Barraza-Guerrero et al. 2020). However, this technique does not discriminate between C. burnetii and Coxiella endosymbionts. In previous studies, C. burnetii had been detected in solid organs and blood of bats from Brazil (Ferreira et al. 2018). To date, C. burnetii is the only species confirmed to be a vertebrate pathogen, capable of causing a systemic disease, that has been reported in bats from Brazil. The molecular phylogeny of Coxiella identified the presence of 4 clades (named as A-D). All Coxiella clades except one (D) include pathogenic and endosymbiont linages. Recently, Brenner et al. (2021) determined that both groups (C. burnetii and Coxiella endosymbionts) evolved from a common pathogenic ancestor. However, the zoonotic potential of other endosymbiont Coxiella in vertebrates, particularly bats, is unknown. Since no biological samples were taken from the vertebrate host in the present study, it is unknown whether the host is infected with the agent.
On the other hand, Coxiella endosymbionts seem to be very common in soft ticks, especially in the genus Ornithodoros (Duron et al. 2015). Previous studies for the detection of Coxiella failed to demonstrate the presence of this microorganism in O. hasei populations from South America (Tahir et al. 2016). For this reason, our record represents the first molecular identification of Coxiella in ticks associated with bats in the Neotropical region.
Recently, Ca. R. wisemanni was detected at a high prevalence in O. hasei from Argentina, Brazil and French Guinea (Tahir et al. 2016; Luz et al. 2019; Colombo et al. 2020). However, this microorganism was not identified in our study, possibly due to the low number of samples analysed. Yet, its presence was not ruled out, and more studies should be carried out to understand its potential distribution in the most north-eastern populations of O. hasei.
The findings of the present work highlight the need to continue with the systematic study of microorganisms associated with soft ticks from Mexican bats, since very little is known about the microbiome of these ectoparasites, which represent an important component of biodiversity.
Acknowledgements
This paper is part of the requirements for obtaining a Doctoral degree at the Posgrado en Ciencias Biológicas, UNAM of E. Grostieta Rojas. Financing was granted by UNAM-PAPIIT AG201221. She receives a scholarship from CONAHCyT. We are very grateful to the owner and the staff of San Basilio Ecotourism Centre for the facilities to carry out this study. Also, to biology students of Facultad de Ciencias Biológicas y Agropecuarias region Tuxpan (FCBA) for their assistance in the fieldwork. Two anonymous reviewers contributed to improve this manuscript.
Literature cited
Acosta, I., et al. 2016. Ticks (Acari: Ixodidae, Argasidae) from humans, domestic and wild animals in the state of Espírito Santo, Brazil, with notes on rickettsial infection. Veterinary Parasitology, Regional Studies and Reports 3-4:66-69.
Aguilar-Domínguez, M., et al. 2019. Genetic structure analysis of Amblyomma mixtum populations in Veracruz State, México. Ticks and Tick-borne Diseases 10:86-92.
Almeida, A. P., et al. 2012. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae). Ticks and Tick-borne Diseases 3:203-206.
Baird, A. B., et al. 2009. Speciation by monobrachial centric fusions: a test of the model using nuclear DNA sequences from the bat genus Rhogeessa. Molecular Phylogenetics and Evolution 50:256-267.
Barraza-Guerrero, S. I., et al. 2020. General microbiota of the soft tick Ornithodoros turicata parasitizing the Bolson Tortoise (Gopherus flavomarginatus) in the Mapimi Biosphere Reserve, México. Biology 9:275.
Bitencourth, K., et al. 2021. Amblyomma aureolatum genetic diversity and population dynamics are not related to Spotted Fever epidemiological scenarios in Brazil. Pathogens 10:1146.
Brenner, A. E., et al. 2021. Coxiella burnetii and related tick endosymbionts evolved from pathogenic ancestors. Genome Biology and Evolution 13:108.
Ceballos, G. (ed.). 2014. Mammals of México. Johns Hopkins University Press. Baltimore, U.S.A.
Colombo, V. C., et al. 2020. First detection of "Candidatus Rickettsia wissemanii" in Ornithodoros hasei (Schulze, 1935) (Acari: Argasidae) from Argentina. Ticks and Tick-Borne Diseases 11:101442.
Cooley, R. A., and G. M. Kohls. 1944. The Argasidae of North America, Central America, and Cuba. The American Midland Naturalist Monograph 1:152.
Davoust, B., et al. 2016. Evidence of Bartonella spp. in blood and ticks (Ornithodoros hasei) of bats, in French Guiana. Vector Borne and Zoonotic Diseases 16:516-519.
de Sousa, R., et al. 2006. Rickettsia sibirica isolation from a patient and detection in ticks, Portugal. Emerging Infectious Diseases 12:1103-1108.
Dick, C. W., et al. 2007. Bolivian Ectoparasites: A Survey of Bats (Mammalia Chiroptera). Comparative Parasitology 74:372-377.
Duron, O., et al. 2015. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q Fever pathogen, Coxiella burnetii. PLoS Pathogens 11:e1004892.
Fairchild, G. B., et al. 1965. The ticks of Panama (Acarina: Ixodoidea). Pp. 167-219 in The Ectoparasites of Panama (Wenzel, W. R., and V. J. Tipton, eds.). R. R. Donnelley and Sons Co. Chicago, U.S.A.
Ferreira, M. S., et al. 2018. Coxiella and Bartonella spp. in bats (Chiroptera) captured in the Brazilian Atlantic Forest biome. BMC Veterinary Research 14:279.
Guimaraes, L. R., and M. A.V. D'Andretta. 1956. Sinopse dos Nycteribiidae (Diptera) do Novo Mondo. Arquivos De Zoologia 10:1-184.
Guzmán-Cornejo, C., et al. 2019. The soft ticks (Parasitiformes: Ixodida: Argasidae) of México: species, hosts, and geographical distribution. Zootaxa 4623:485-525.
Hornok, S., et al. 2019. Molecular detection of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of the Old and New Worlds. Parasites and Vectors 12:50.
Jones, E. K., et al. 1972. The ticks of Venezuela (Acarina: Ixodoidea) with a key to the species of Amblyomma in the Western Hemisphere. Brigham Young University Science Bulletin, Biological Series 17:1-40.
Kohls, G. M., et al. 1965. The systematics of the subfamily Ornithodorinae (Acarina: Argasidae). II. Identification of the larvae of the Western Hemisphere and descriptions of 3 new species. Annals of the Entomological Society of America 58:331-364.
Luz, H. R., et al. 2019. Detection of “Candidatus Rickettsia wissemanii” in ticks parasitizing bats (Mammalia: Chiroptera) in the northern Brazilian Amazon. Parasitol Research 118:3185-3189.
Mans, B. J., et al. 2019. Argasid and ixodid systematics: Implications for soft tick evolution and systematics, with a new argasid species list. Ticks and Tick-borne Diseases 10:219-240.
Marinkelle, C. J., and E. S. Grose. 1981. A list of ectoparasites of Colombian bats. Revista de Biologia Tropical 29:11-20.
Masuzawa, T., et al. 1997. Identification of rickettsiae isolated in Japan as Coxiella burnetii by 16S rRNA sequencing. International Journal of Systematic Bacteriology 47:883-884.
Matheson, R. 1935. Three new species of ticks, Ornithodoros (Acarina:Ixodoidea). Journal of Parasitology 21:347-353.
Medellín, R. A., et al. 2007. Identificación de los murciélagos de México, Clave de campo, segunda edición. Instituto de Ecología, UNAM. México City, México.
Muñoz-Leal, S., et al. 2016. Ticks infesting bats (Mammalia: Chiroptera) in the Brazilian Pantanal. Experimental & Applied Acarology 69:73-85.
Muñoz-Leal, S., et al. 2018. New records of ticks infesting bats in Brazil, with observations on the first nymphal stage of Ornithodoros hasei. Experimental and Applied Acarology 76:537-549.
Muñoz-Leal, S., et al. 2021. Novel Borrelia genotypes in bats from the Macaregua Cave, Colombia. Zoonoses and Public Health 68:12-18.
Murphy, D. S., et al. 2017. Prevalence and distribution of human and tick infections with the Ehrlichia muris-Like agent and Anaplasma phagocytophilum in Wisconsin, 2009-2015. Vector Borne and Zoonotic Diseases 17:229-236.
Nava, S., et al. 2007. The ticks (Acari: Ixodida: Argasidae, Ixodidae) of Paraguay. Annals of Tropical Medicine and Parasitology 101:255-270.
Norman, A. F., et al. 1995. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. Journal of Clinical Microbiology 33:1797-1803.
Norris, D. E., et al. 1996. Population genetics of Ixodes scapularis (Acari: Ixodidae) based on mitochondrial 16S and 12S genes. Journal of Medical Entomology 33:78-89.
Ossa-López, P. A., et al. 2023. Morphological and molecular confirmation of Ornithodoros hasei (Schulze, 1935) (Acari: Argasidae) in Colombia. Ticks and Tick-Borne Diseases 14:102142.
Parola, P., and D. Raoult. 2001. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clinical Infectious Diseases 32:897-928.
Rudenko, N., et al. 2009. Borrelia carolinensis sp. nov., a new (14th) member of the Borrelia burgdorferi sensu lato complex from the southeastern region of the United States. Journal of Clinical Microbiology 47:134-141.
Sánchez-Montes, S., et al. 2016. Rickettsia lusitaniae associated with Ornithodoros yumatensis (Acari: Argasidae) from 2 caves in Yucatan, México. Ticks and Tick-Borne Diseases 7:1097-1101.
Sándor, A. D., et al. 2021. Argasid ticks of palearctic bats: distribution, host selection, and zoonotic importance. Frontiers Veterinary Science 8:684737.
Schulze, P. 1935. Zur vergleichenden Anatomie der Zecken. (Das Sternale, die Mundwerkzeuge, Analfurchen und Analbeschilderung ihre Bedeutung, Ursprünglichkeit und Luxurieren). Zeitschrift für Morphologie und Ökologie der Tiere 30:1-40.
Tahir, D., et al. 2016. New Rickettsia species in soft ticks Ornithodoros hasei collected from bats in French Guiana. Ticks and Tick-Borne Diseases 7:1089-1096.
Theodor, O. 1967. An illustrated catalogue of the Rothschild collection of Nycteribiidae (Diptera) in the British Museum (Natural History) with keys and short descriptions for the identification of subfamilies, general, species, and subspecies. London, England.
Uchikawa, K., and A. Baker. 1993. A new classification for the subgenera of the genus Acanthophthirius Perkins, with descriptions of twelve new taxa (Acarina, Trombidiformes, Myobiidae). Systematic Parasitology 25:81-108.
Ujvari, B., et al. 2004. High prevalence of Hepatozoon spp. (Apicomplexa: Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of Parasitology 90:670-672.
Associated editor: Gloria Tapia Ramírez.
Submitted: March 6, 2024; Reviewed: April 9, 2024.
Accepted: April 30, 2024; Published on line: May 27, 2024.
Appendix 1
List of known host species and localities of the soft tick Ornithodoros hasei across the Neotropical region. NR: Not recorded; F: Female; M: Male; N: Nymph; L: Larvae.
|
Order |
Family |
Scientific name |
Common name |
Country |
Locality |
Tick stage |
Collection date |
Bacterial detected |
Reference |
|
Chiroptera |
Emballonuridae |
Peropteryx sp. |
- |
Venezuela |
10 km S, 18 km W Machiques, Kasmera, Zulia |
2L |
15 April, 1968 |
NR |
Jones et al. 1972 |
|
Molossidae |
Eumops sp. |
- |
Bolivia |
San Joaquin, Beni and Magdalena |
NR |
March-September, 1963 |
NR |
Kohls et al. 1965 |
|
|
Molossus bondae |
Bonda Mastiff Bat |
Venezuela |
About 10 km NW Urama, Yaracuy |
1L |
14 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Molossus bondae |
Bonda Mastiff Bat |
Venezuela |
Montalbán, Carabobo |
2L |
5 September, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus molossus |
Pallas's mastiff bat |
Colombia |
Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region |
11L |
1 November 2021 |
NR |
Ossa-López et al. 2023 |
||
|
Molossus molossus |
Pallas's mastiff bat |
Colombia |
NR |
3 |
NR |
NR |
Marinkelle and Grose 1981 |
||
|
Molossus nigricans |
Ebon Mastiff Bat |
Mexico |
Piste, Yucatán |
43L |
July 20-21, 1962 |
NR |
Kohls et al. 1965 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
1/4 km N San Juan, E side Río Manapiare, Harder |
4L |
5 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
14 km E Cumaná, Hda. Guanital, Sucre |
12L |
9 December, 1966 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
2 km N Tamanaco, near San Juan Río Manapiare, Harder |
1L |
19 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
2 km N Tamanaco, near San Juan, Río Manapiare, Harder |
2L |
17 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
2-3 km N, 4 km W Caripe, San Agustín, Monagas |
36L |
26 June-07 July 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
38 km NW Pto. Paez, Hato Cariben, Río Cinaruco, Apure |
1M, 1N |
17 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
38 km NW Pto. Paez, Río Cinaruco, Apure |
1F, 2N, 1L |
17 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
46 km NE Pto. Paez, Hato Cariben, Río Cinaruco, Apure |
1M, 1N, 1L |
13,17 January, 1965 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
46 km NE Pto. Paez, Hato Cariben, Río Cinaruco, Apure |
1L |
28 July, 1965 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
59 km SE , km 74, El Manaco, Bolivar |
35L |
8-17 June, 1966 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Ca. 2 km N Tamanaco, near San Juan, Río Manapiare, Harder |
7L |
24 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Near San Agustín, Monagas |
25L |
8 July 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Near Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder |
14L |
14,19 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder |
2L |
14 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Tamanaco, ca. 4 km NE San Juan, Río Manapiare, T. F. Amazonas |
6L |
14 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossus rufus |
Black Mastiff Bat |
Venezuela |
Tamanaco, near San Juan, Río Manapiare, Harder |
2L |
25 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Molossops temminckii |
Dwarf Dog-faced Bat |
Argentina |
Sociedad Rural “Las Colonias”, Esperanza city |
5L |
January 2018 |
NR |
Colombo et al. 2020 |
||
|
Mormoops megalophylla |
Peters's Ghost-faced Bat |
Venezuela |
9 km N, 4 km E Guiria near Río Salado, Sucre |
1L |
7 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Neoplatymops mattogrossensis |
Mato Grosso Dog-faced Bat |
Venezuela |
33 km SSE Puerto Ayacucho, El Raudal, Harder |
25L |
4, 10 October, 1967 |
NR |
Jones et al. 1972 |
||
|
Tadarida sp. |
- |
Venezuela |
38 km NW Pto. Paez, Río Cinaruco, Apure |
1L |
21 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Tadarida sp. |
- |
Venezuela |
Boca Mavaca, Río Orinoco, 84 km SSE Esperalda, Harder |
5L |
14 Frebruary, 1966 |
NR |
Jones et al. 1972 |
||
|
Tadarida sp. |
- |
Venezuela |
Río Cunucunuma, near Belén, Harder |
3L |
13 January, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilionidae |
Noctilio albiventris |
Lesser Bulldog Bat |
Brazil |
Mato Grosso do Sul state |
3L |
2006-2008 |
NR |
Muñoz-Leal et al. 2018 |
|
|
Noctilio albiventris |
Lesser Bulldog Bat |
Colombia |
Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region |
86L |
31 October 2021, 1 November 2021 |
NR |
Ossa-López et al. 2023 |
||
|
Noctilio albiventris |
Lesser Bulldog Bat |
Colombia |
Vereda El Socorro, Finca Marsella, municipality of Arauca, Department of Arauca, Orinoquia region |
43L |
3 November 2021 |
NR |
Ossa-López et al. 2023 |
||
|
Noctilio albiventris |
Lesser Bulldog Bat |
Colombia |
NR |
4 |
NR |
NR |
Marinkelle and Grose 1981 |
||
|
Noctilio albiventris |
Lesser Bulldog Bat |
French Guiana |
Saint-Jean-du-Maroni |
354L |
January 2013 |
31L Candidatus Rickettsia wissemanii |
Tahir et al. 2016 |
||
|
Noctilio albiventris |
Lesser Bulldog Bat |
French Guiana |
Saint-Laurent-du-Maroni |
355L |
January and February 2013 |
4L Bartonella sp. |
Davoust et al. 2016 |
||
|
Noctilio albiventris |
Lesser Bulldog Bat |
Trinidad |
Santa Cruz,6 km by road W of Ascención |
7L |
13 August 1985 |
NR |
Dick et al. 2007 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Bolivia |
San Joaquin, Beni and Magdalena |
Aprox 575L |
March-September, 1963 |
NR |
Kohls et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Brazil |
Mato Grosso do Sul state |
NR |
2006-2008 |
NR |
Muñoz-Leal et al. 2016 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Brazil |
Serinhaém, Pernambuco |
19L, 2N |
nov, 2016 |
NR |
Muñoz-Leal et al. 2018 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Colombia |
NR |
2 |
NR |
NR |
Marinkelle and Grose 1981 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Costa Rica |
9 mi ENE of Puerto Golfito, Puntarenas Province |
29L |
March 15, 1963 |
NR |
Kohls et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Nicaragua |
Rama, Bluefiels |
2L |
April 29, 1963 |
NR |
Kohls et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Panama |
Yard of the Panama Hospital, Panama City |
32L |
March 17, 1931 |
NR |
Matheson 1935 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Panama |
Summit Canal Zone |
NR |
September 30, 1932 |
NR |
Matheson 1935 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Panama |
Pacora |
1N, several larvae |
June 21, 22, July 26, 1961 |
NR |
Fairchild et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Panama |
Navy firing point, Galeta Point, Canal Zone |
2N |
November 19, 1959 |
NR |
Fairchild et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Paraguay |
Fortín Juan de Zalazar |
3L |
25 September 1973 |
NR |
Nava et al. 2007 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Paraguay |
Fortín Juan de Zalazar |
2L |
27 September 1973 |
NR |
Nava et al. 2007 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Trinidad |
Avocat |
10L** |
September 21, 1961 |
NR |
Kohls et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Trinidad |
North Manzanilla |
21L |
February 28, 1957 |
NR |
Kohls et al. 1965 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
19 km NW Urama, Yaracuy |
50L |
9 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
2 km N Tamanaco, near San Juan Río Manapiare, Harder |
75L |
18 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
2 km N Tamanaco, near San Juan, Río Manapiare, T. F. Amazonas |
88L |
17-19 August, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
20 km SSE Puerto Ayacucho Las Queseras, Harder |
8L |
24 September, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
23 km NW Valera, near Agua Santa, Trujillo |
8L |
24 August, 1965 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
35 km NW Pto. Cabello, Boca de Yaracuy, Yaracuy and Falcón |
92L |
22, 29 October, 1965; 2 October, 1965 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
38 km NW Pto. Paez, Río Cinaruco, Apure |
255L |
17 January 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
42 km WNW ENcontrados, El Rosario, Zulia |
4L |
5 March, 1968 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
46 km NE Pto. Paez, Hato Caribean, Rio Cinaruco, Apure |
2M, 4F, 3N, 863L |
15 July 1965-17 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
5 km E Río Chico, nr. Puerto Tuy, Miranda |
59L |
5, 17 September, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
About 10 km NW Urama, Yaracuy |
1L |
11 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
About 10 km NW Urama, Yaracuy |
3L |
14 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
Moracoy, near San Juan, W side Río Manapiare, Harder |
105L |
24 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
Near Moracoy, ca. 15 km down Río Manapiare from San Juan, Harder |
100L |
14 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
Near San Juan, E side Rio Manapiare, Harder |
1L |
19 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
San Juan, Río Manapiare, Harder |
57L |
14 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
San Juan Río Manapiare, Harder |
100L |
20 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
W side Río Manapiare. near San Juan, Harder |
200L |
24 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
Yaracuy-Carabobo border, NW of Urama, Yaracuy and Carabobo |
54L |
17 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus/Myotis albescens |
Greater Bulldog Bat/Silver-tipped Myotis |
Venezuela |
Ca. 2 km N Tamanaco, nr. San Juan, Río Manapiare, Harder |
11L |
18, 26 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
10 km E Río Chico nr. Ticarigua La Laguna, Miranda |
50L |
9 November, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
21 km E Cumaná, Hda. Tunantal, Sucre |
51L |
10, 17 December, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
38 km NW Pto. Paez, Río Cinaruco, Apure |
1L |
13 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
42 km WNW ENcontrados, El Rosario, Zulia |
2L |
5, 28 March, 1968 |
NR |
Jones et al. 1972 |
||
|
Noctilio leporinus |
Greater Bulldog Bat |
Venezuela |
5 km E Río Chico nr. Puerto Tuy, Miranda |
5L |
17 November, 1966 |
NR |
Jones et al. 1972 |
||
|
Noctilio sp. |
NR |
Panama |
Gamboa (canal Zone), pipeline road |
NR |
May 14, 1962 |
NR |
Fairchild et al. 1965 |
||
|
Phyllostomidae |
Artibeus jamaicensis |
Jamaican Fruit-eating Bat |
Colombia |
NR |
54 |
NR |
NR |
Marinkelle and Grose 1981 |
|
|
Artibeus jamaicensis s.l. |
Jamaican Fruit-eating Bat |
Venezuela |
14 km S, 45 Km E Caicara, Hato La Florida, Bolivar |
35L |
NR |
NR |
Jones et al. 1972 |
||
|
Artibeus jamaicensis s.l. |
Jamaican Fruit-eating Bat |
Venezuela |
5 km NW Guasipati, Bolivar |
6L |
29 April, 1966 |
NR |
Jones et al. 1972 |
||
|
Artibeus jamaicensis s.l. |
Jamaican Fruit-eating Bat |
Venezuela |
San Juan Río Manapiare, Harder |
1L |
24 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Artibeus lituratus |
Great Fruit-eating Bat |
Brazil |
Pinheiros, Espírito Santo |
17L |
2012 |
NR |
Acosta et al. 2016 |
||
|
Artibeus lituratus |
Great Fruit-eating Bat |
Costa Rica |
Majica Ranch, Guanacaste Province |
16L |
August 10, 1960 |
NR |
Kohls et al. 1965 |
||
|
Artibeus planirostris |
Flat-faced Fruit-eating Bat |
Brazil |
Mato Grosso do Sul state |
289 L |
2006-2008 |
NR |
Muñoz-Leal et al. 2016 |
||
|
Artibeus planirostris |
Flat-faced Fruit-eating Bat |
Brazil |
Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará |
296L |
July 2012, February 2013 |
NR |
Luz et al. 2019 |
||
|
Artibeus planirostris |
Flat-faced Fruit-eating Bat |
Brazil |
southeastern region of the Amapá state |
160L |
October 2016 and November 2017 |
1 pool Candidatus R. wissemanii |
Luz et al. 2019 |
||
|
Carolia perspicillata |
Seba's Short-tailed Bat |
Brazil |
Tamandaré, Pernambuco |
34L, 17N |
May-15 |
NR |
Muñoz-Leal et al. 2018 |
||
|
Carollia perspicillata |
Seba's Short-tailed Bat |
Venezuela |
W side Río Manapiare, near San Juan, Harder |
1L |
24 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Carollia sp. |
- |
Venezuela |
Near Tamanaco, ca. 4 km NE San Juan, Río Manapiare, Harder |
1L |
19 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Chiroderma salvini |
Salvin's Big-eyed Bat |
Venezuela |
3 km N, 4 km W Caripe, San Agustin, Monagas |
1L |
27 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Desmodus rotundus |
Common Vampire Bat |
Venezuela |
35 km NW Pto. Cabello, Boca de Yaracuy, Yaracuy and Falcón |
1L |
30 October, 1965 |
NR |
Jones et al. 1972 |
||
|
Desmodus rotundus |
Common Vampire Bat |
Venezuela |
38 km NW Pto. Paez, Río Cinaruco, Apure |
1L |
13 January, 1966 |
NR |
Jones et al. 1972 |
||
|
Glossophaga longirostris |
Miller's Long-tongued Bat |
Venezuela |
46 km NE Pto. Paez, Hato Cariben, Rio Cinaruco, Apure |
1L |
July 14 1965 |
NR |
Jones et al. 1972 |
||
|
Glossophaga soricina |
Pallas's Long-tongued Bat |
Brazil |
Serinhaém, Pernambuco |
3L |
November, 2008 |
NR |
Muñoz-Leal et al. 2018 |
||
|
Lonchorhina orinocensis |
Orinocoan Sword-nosed Bat |
Venezuela |
46 km NE Pto. Paez, Hato Cariben, Rio Cinaruco, Apure |
1L |
24 July 1965 |
NR |
Jones et al. 1972 |
||
|
Lophostoma brasiliense |
Pygmy Round-eared Bat |
Brazil |
Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará |
6L |
July 2012, February 2013 |
NR |
Luz et al. 2019 |
||
|
Lophostoma silvicola |
White-Throated Round-Eared Bat |
Panama |
Las Palmitas (Los Santos) |
NR |
January-February, 1962 |
NR |
Fairchild et al. 1965 |
||
|
Gardnerycteris crenulatum |
Striped Hairy-nosed Bat |
Brazil |
Mato Grosso do Sul state |
3L |
2006-2008 |
NR |
Muñoz-Leal et al. 2016 |
||
|
Gardnerycteris crenulatum |
Striped Hairy-nosed Bat |
Venezuela |
19 km NW Urama Km 40, Yaracuy and Carabobo |
5L |
26 October, 1965 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus discolor |
Pale spear-nosed bat |
Colombia |
NR |
1 |
NR |
NR |
Marinkelle and Grose 1981 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Brazil |
Mato Grosso do Sul state |
55L |
2006-2008 |
NR |
Muñoz-Leal et al. 2016 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
13 km NW Urama, Río Yaracuy, Yaracuy |
4L |
20 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
23 km NW Valera, near Agua Santa, Trujillo |
2L |
18 October, 1965 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
5 km S, 25 km E Carúpano, Manacal, Sucre |
1L |
3 August, 1966 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
6 km N Urama, Carabobo |
9L |
17 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
About 11 km NW Urama, near El Central, Yaracuy |
2L |
14 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
Moracoy, near Río Manapiare, Harder |
25L |
13 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
San Juan, Río Manapiare, Harder |
1L |
17 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
Near Moracoy, 15 km down Río Manapiare from San Juan, Harder |
1L |
NR |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
San Juan, Río Manapiare, Harder |
1L |
17 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Phyllostomus hastatus |
Greater Spear-nosed Bat |
Venezuela |
San Juan, Río Manapiare, Harder |
50L |
17 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Platyrrhinus helleri |
Heller's Broad-Nosed Bat |
Panama |
Las Palmitas (Los Santos) |
NR |
January-February, 1962 |
NR |
Fairchild et al. 1965 |
||
|
Platyrrhinus lineatus |
White-lined Broad-nosed Bat |
Brazil |
Mato Grosso do Sul state |
12 L |
2006-2008 |
NR |
Muñoz-Leal et al. 2016 |
||
|
Sturnira giannae |
Gianna's Yellow-shouldered Bat |
Venezuela |
4 km NNW Caracas, Distrito Federal |
8L |
23 July, 1965 |
NR |
Jones et al. 1972 |
||
|
Sturnira lilium |
Little Yellow-shouldered Bat |
Brazil |
Caetité, Bahía |
19L |
December 2014 |
NR |
Muñoz-Leal et al. 2018 |
||
|
Sturnira lilium |
Little Yellow-shouldered Bat |
Venezuela |
14 km E Cumaná, Hda. Guanital, Sucre |
30L |
8-9 December, 1966 |
NR |
Jones et al. 1972 |
||
|
Tonatia bidens |
Greater Round-eared Bat |
Brazil |
Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará |
10L |
July 2012, February 2013 |
NR |
Luz et al. 2019 |
||
|
Tonatia sp. |
- |
Brazil |
Private Reserve of the Natural Patrimony Serra das Almas, Municipality of Crateús, state of Ceará |
4L |
July 2012, February 2013 |
NR |
Luz et al. 2019 |
||
|
Uroderma bilobatum |
Tent-Making Bat |
Panama |
Las Palmitas (Los Santos) |
NR |
January-February, 1962 |
NR |
Fairchild et al. 1965 |
||
|
Uroderma magnirostrum |
Brown Tent-making Bat |
Venezuela |
Near San Juan, Río Manapiare, Harder |
20L |
17 July, 1967 |
NR |
Jones et al. 1972 |
||
|
Vespertilionidae |
Aeorestes cinereus |
Hoary bat |
Colombia |
NR |
1 |
NR |
NR |
Marinkelle and Grose 1981 |
|
|
Eptesicus diminutus |
Diminutive Serotine |
Argentina |
Sociedad Rural “Las Colonias”, Esperanza city |
3L |
January 2018 |
3L Candidatus “R. wissemanii” |
Colombo et al. 2020 |
||
|
Eptesicus furinalis |
Argentinian Brown Bat |
Argentina |
Cululú river banks, town of Cululú |
4L |
January 2018 |
NR |
Colombo et al. 2020 |
||
|
Eptesicus furinalis |
Argentinian Brown Bat |
Argentina |
Santa Fe de la Veracruz city |
3L |
November 2017 |
NR |
Colombo et al. 2020 |
||
|
Eptesicus orinocensis |
Orinoco brown bat |
Colombia |
Vereda El Socorro, Finca Los Trompillos, municipality of Arauca, Department of Arauca, Orinoquia region |
33L |
1 November 2021 |
NR |
Ossa-López et al. 2023 |
||
|
Eptesicus sp. |
- |
Argentina |
Santa Fe de la Veracruz city |
7L |
November 2017 |
NR |
Colombo et al. 2020 |
||
|
Myotis nigricans |
Black Myotis |
Venezuela |
Gueiira |
NR |
NR |
NR |
Schulze 1935 |
||
|
Myotis velifer velifer |
Cave Myotis |
Mexico |
Santa Lucía, Sinaloa |
1L |
July 28, 1963 |
NR |
Kohls et al. 1965 |
||
|
Rhogeessa minutilla |
Tiny Yellow Bat |
Venezuela |
114 km N, 32 km W Maracaibo near Cojoro, Zulia |
4L |
24 June, 1968 |
NR |
Jones et al. 1972 |
||
|
Rhogeessa parvula |
Little yellow bat |
Colombia |
NR |
2 |
NR |
NR |
Marinkelle and Grose 1981 |
||
|
Rhogeessa sp. |
- |
Venezuela |
19 km NW Urama, Yaracuy |
4L |
9 March, 1966 |
NR |
Jones et al. 1972 |
||
|
Rodentia |
Cricetidae |
Necromys urichi |
Northern Grass Mouse |
Venezuela |
3 km N, 4 km W Caripe, San Agustín, Monagas |
1L |
24 June 1967 |
NR |
Jones et al. 1972 |
|
Questing |
NR |
Tree hole |
NR |
Brazil |
Marajó Island, Belém, Pará |
1F |
June 1941 |
NR |
Cooley and Kohls 1944 |
|
NR |
Bat guano |
NR |
Panama |
Pacora |
Members of all life cycle |
June 21, 22, July 26, 1961 |
NR |
Fairchild et al. 1965 |
Appendix 2
Primers used for molecular detection of tickborne pathogens.
|
Parasite |
Gene |
Primers |
Size (bp) |
Positive control |
Reference |
|
Protozoa |
|||||
|
Babesia spp. |
18S rDNA |
BAB01 CCGTGCTAATTGTAGGGCTAATACA |
571 |
Babesia bigemina [MZ798903] |
Almeida et al. 2012 |
|
BAB02 GCTTGAAACACTCTARTTTTCTCAAAG |
|||||
|
Hepatozoon spp. |
18S rDNA |
HepF300 GTTTCTGACCTATCAGCTTTCGACG |
495 |
Hepatozoon spp. from Crotalus molossus [MT385834] |
Ujvari et al. 2004 |
|
HepR900 CAAATCTAAGAATTTCACCTCTGAC |
|||||
|
Bacteria |
|||||
|
Anaplasma/Ehrlichia spp. |
16S rDNA |
EHR01F GCCTAACACATGCAAGTCGAACG |
495 |
Anaplasma marginale [MN453603] |
Murphy et al. 2017 |
|
EHR02R GCCCAATAATTCCGAACAACG |
|||||
|
Bartonella spp. |
gltA |
BhCS781.p GGGGACCAGCTCATGGTGG |
379 |
Bartonella quintana [OM108475] |
Norman et al. 1995 |
|
BhCS1137.n AATGCAAAAAGAACAGTAAACA |
|||||
|
Borrelia spp. |
flaB |
FlaoutF AARGAATTGGCAGTTCAATC |
470 |
Borrelia burgdorferi [MK370994] |
Rudenko et al. 2009 |
|
FlaoutR GCATTTTCWATTTTAGCAAGTGATG |
|||||
|
Coxiella spp. |
23S rDNA |
QR-FO ATTGAAGAGTTTGATTCTGG |
1000 |
Coxiella endosymbiont of Amblyomma mixtum [OM307605] |
Masuzawa et al. 1997 |
|
QR-RO CGGCCTCCCGAAGGTTAG |
|||||
|
Rickettsia spp. |
gltA |
RpCS.415 GCTATTATGCTTGCGGCTGT |
806 |
Rickettsia amblyommatys [MW539675] |
de Sousa et al. 2006 |
|
RpCS.1220 TGCATTTCTTTCCATTGTGC |
Figure 1. Geographic records of the soft tick, Ornithodoros hasei in the Neotropical region based on literature. We highlight in a yellow star the new geographic record found in Tuxpan, Veracruz on the eastern coast of México. Black points refer to previous records.
Figure 2. Morphological and molecular identification of Ornithodoros hasei. Optical micrographs of O. hasei larva collected in Tuxpan, Veracruz, México. a) Ventral view, b) dorsal plate, and c) hypostome; d) Phylogenetic reconstruction based on a partial fragment of the 16S-rDNA gene of several soft ticks inferred by Maximum Likelihood and based in the General Time Reversible Model (GTR). Sequences in the study are marked with solid figures. Bootstrap values are indicated at the nodes. Scale bar at the bottom represents the degree of divergence; e) haplotype network for the 16S-rDNA fragment of O. hasei from the Neotropical region. The colors correspond to each country. Black lines represent the mutational steps between each haplotype; black dots symbolize unrecovered haplotypes.
Figure 3. Phylogenetic reconstruction based on a partial fragment of the 16S-rDNA gene of several Coxiella linages inferred by Maximum Likelihood and based on Kimura two parameter Model (K2). Bootstrap values are indicated at the nodes. Scale bar at the bottom represents the degree of divergence. Sequences in the study are marked with solid figures.